View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13886_low_5 (Length: 350)
Name: NF13886_low_5
Description: NF13886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13886_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 124 - 335
Target Start/End: Complemental strand, 19784145 - 19783934
Alignment:
| Q |
124 |
catataagtttttggagggttctacgataaactactttgataaatagtctatgttaaattaaaacttgaaaattactcaagataaaaatggcaatcgatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19784145 |
catataagtttttggagggttctacgataaactactttgataaatagtctatgttaaattaaaacttgaaaattactcaagataaaaatggcaatcgatg |
19784046 |
T |
 |
| Q |
224 |
ctgtccttggaagtagattttaacaaccatcatttttctcacgaatgagacaatgatttgattagtgtcaatgtagtgaactagtataaattatggcatc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19784045 |
ttgtccttggaagtagattttaacaaccatcatttttctcacgaatgagacgatgatttgattagtgtcaatgtagtgaactagtataaattatggcatc |
19783946 |
T |
 |
| Q |
324 |
gtcttagttagt |
335 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19783945 |
gtcttagttagt |
19783934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 12 - 60
Target Start/End: Complemental strand, 19784257 - 19784209
Alignment:
| Q |
12 |
attctcactatatatgaccaaatatgtgcattttgtgtataaaatatga |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19784257 |
attctcactatatatgaccaaatatgtgcatgttgtgtataaaatatga |
19784209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University