View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13887_high_1 (Length: 435)
Name: NF13887_high_1
Description: NF13887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13887_high_1 |
 |  |
|
| [»] scaffold0741 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (1 HSPs) |
 |  |  |
|
| [»] scaffold0363 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 28122533 - 28122302
Alignment:
| Q |
1 |
tcatcagcaaacttaatgtggtaaggtattttgggaggtgataagttatagatgagggaggagttactagctataaaatcaaaagctcaagaatctgaaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122533 |
tcattagcaaacttaatgtggtaaggtattttgggaggtgacaagttatagatgagtgaggagttactagctataaaatcaaaagctcaagaatctgaaa |
28122434 |
T |
 |
| Q |
101 |
accaagatcccacttgtttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122433 |
accaagatcccacttgtttaataatatttattttatgaggttggcggcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttc |
28122334 |
T |
 |
| Q |
201 |
tccctgatgcatgtcctcctcttaattcagct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28122333 |
tccctgatgcatgtcctcctcttaattcagct |
28122302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 285 - 419
Target Start/End: Complemental strand, 28122249 - 28122115
Alignment:
| Q |
285 |
gactgatgagtaaaacttgttagactgccatcaaactacaaacaataataagccttgagtgagtaaaagtgagtatagagaggcatcacacattaatgcc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28122249 |
gactgatgagtaaaacttgttagactgccatcaaactacaaacaataataagccttgagtgagtaaaagtgagtatagagaggcatcacacattaatgcc |
28122150 |
T |
 |
| Q |
385 |
aaaggaaaaaagcagccacacaaaaaccaaaatag |
419 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28122149 |
aaaggaaaaaagcagccacgcaaaaaccaaaatag |
28122115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 151 - 192
Target Start/End: Original strand, 28637632 - 28637672
Alignment:
| Q |
151 |
aggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
28637632 |
aggatgggggttcctc-ggggtgccaacctagttgggatgtc |
28637672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 37634437 - 37634396
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgggatg |
190 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
37634437 |
agaggatgggggtttctgtgggatgccaacctagttgggatg |
37634396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 21027095 - 21027040
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||| ||| |||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
21027095 |
tgagtttggcggcataggatgggggtt-ctgcggggtgccaacctagttgggatgtc |
21027040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 22602110 - 22602055
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||| | ||| |||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
22602110 |
tgaggttgacggcataggatgggggtt-ctgcggggtgccaacctagttgggatgtc |
22602055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 8709709 - 8709595
Alignment:
| Q |
114 |
ttgtttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttctccctgatgcatg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||| ||| || | ||||||| ||||||| || ||||| ||||||||||||| ||||||| |
|
|
| T |
8709709 |
ttgtttaataatatttattttatgtggttggtggcaaaggataggg--tttttaggggtgtcaacctacatgagatgtatgaggttctccct-atgcatg |
8709613 |
T |
 |
| Q |
214 |
tcctcctcttaattcagc |
231 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
8709612 |
tccttctcttgattcagc |
8709595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 114 - 231
Target Start/End: Complemental strand, 9061596 - 9061482
Alignment:
| Q |
114 |
ttgtttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttctccctgatgcatg |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||| ||| || | ||||||| ||||||| || ||||| ||||||||||||| ||||||| |
|
|
| T |
9061596 |
ttgtttaataatatttattttatgtggttggtggcaaaggataggg--tttttaggggtgtcaacctacatgagatgtatgaggttctccct-atgcatg |
9061500 |
T |
 |
| Q |
214 |
tcctcctcttaattcagc |
231 |
Q |
| |
|
|||| ||||| ||||||| |
|
|
| T |
9061499 |
tccttctcttgattcagc |
9061482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 192
Target Start/End: Original strand, 3736486 - 3736535
Alignment:
| Q |
142 |
tggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3736486 |
tggcagcagaggatggaggtgtctc-ggggtgccaacctagttgggatgtc |
3736535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 210
Target Start/End: Complemental strand, 18385346 - 18385305
Alignment:
| Q |
169 |
gggtgccaacctagttgggatgtctgaggttctccctgatgc |
210 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
18385346 |
gggtgccaacctagttgggatgtttcagcttctccctgatgc |
18385305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 117 - 201
Target Start/End: Complemental strand, 1711264 - 1711180
Alignment:
| Q |
117 |
tttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttct |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||| |||| | ||||||||||||| ||||||||| |||||| |
|
|
| T |
1711264 |
tttattaatatttattttatgaggttggcggcagaggataaaagttcctcaaagatgccaacctagttaggatgtctgtggttct |
1711180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 147 - 190
Target Start/End: Complemental strand, 4790229 - 4790186
Alignment:
| Q |
147 |
gcagaggatgggggtttctcaggggtgccaacctagttgggatg |
190 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4790229 |
gcagaggatggaggtttctgtggggtgccaacctagttgggatg |
4790186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 192
Target Start/End: Complemental strand, 9351198 - 9351148
Alignment:
| Q |
141 |
ttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||| ||| ||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
9351198 |
ttggcggcataggatggaggtttctc-ggggtgccaacctagttgggatgtc |
9351148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 25823566 - 25823633
Alignment:
| Q |
143 |
ggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttctccctgatgc |
210 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||||| ||| || || ||||||| ||||| |
|
|
| T |
25823566 |
ggcagtagcggatgggggtttctgtggggtgccaacctagttggaatgcctcagattctcccggatgc |
25823633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 130 - 192
Target Start/End: Original strand, 12435947 - 12436008
Alignment:
| Q |
130 |
attttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||| |||| ||||| ||| ||||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
12435947 |
attttttgagcttggcggcataggatggaggtttgtc-ggggtgccaacctagttgggatgtc |
12436008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 112 - 191
Target Start/End: Complemental strand, 19424906 - 19424827
Alignment:
| Q |
112 |
acttgtttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgt |
191 |
Q |
| |
|
|||| |||||| || |||||||||||| |||||| | |||||||| ||||||||| ||| |||||||||| |||| |||| |
|
|
| T |
19424906 |
acttttttaatgatgtttattttatgacgttggcgggagaggatgagggtttctcggggatgccaacctaattggaatgt |
19424827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 130 - 192
Target Start/End: Complemental strand, 11485282 - 11485221
Alignment:
| Q |
130 |
attttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||| ||||| ||| ||||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
11485282 |
attttatgagtttggcggcataggatggaggcctctc-ggggtgccaacctagttgggatgtc |
11485221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 117 - 196
Target Start/End: Complemental strand, 35795883 - 35795805
Alignment:
| Q |
117 |
tttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgag |
196 |
Q |
| |
|
|||||||||||| |||||| | ||| ||| |||| |||| ||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
35795883 |
tttaataatattgattttacg-ggtcggcgacagatgatgagggattctcaggggtgccaacctagttgggatgtttgag |
35795805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 142 - 192
Target Start/End: Original strand, 20632469 - 20632518
Alignment:
| Q |
142 |
tggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||||||| |||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
20632469 |
tggcagcaggggatggaggtgtctc-ggggtgccaacctagttgggatgtc |
20632518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 21862602 - 21862639
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgg |
186 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21862602 |
agaggatgggggtttctgtggggtgccaacctagttgg |
21862639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 15718819 - 15718874
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||||| ||||||||||||||| || ||| ||||||||||||| ||||||| |
|
|
| T |
15718819 |
tgagtttggcagtagaggatgggggtttatc-gggatgccaacctagtttggatgtc |
15718874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 20374196 - 20374141
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||||||| |||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
20374196 |
tgagtttggcagcataggatgggggtt-ctgcggggtggcaacctagttgggatgtc |
20374141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 28581219 - 28581159
Alignment:
| Q |
129 |
tattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggat |
189 |
Q |
| |
|
||||||||||| ||| ||| |||||| ||||||||||| ||| |||||||||||||||| |
|
|
| T |
28581219 |
tattttatgagacaggcggcaaaggatgagggtttctcagaggttccaacctagttgggat |
28581159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 141 - 217
Target Start/End: Complemental strand, 40926535 - 40926460
Alignment:
| Q |
141 |
ttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtctgaggttctccctgatgcatgtcct |
217 |
Q |
| |
|
||||| ||| ||||||| |||||| | ||||||||||||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
40926535 |
ttggcggcataggatggaggtttccc-ggggtgccaacctagttgggatgtcgatgtttcctcctgatgcatgtcct |
40926460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0741 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0741
Description:
Target: scaffold0741; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 6758 - 6799
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgggatg |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6758 |
agaggatgggggtttctgtggggtgccaacctagttgggatg |
6799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 42861 - 42902
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgggatg |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42861 |
agaggatgggggtttctgtggggtgccaacctagttgggatg |
42902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 16290860 - 16290910
Alignment:
| Q |
141 |
ttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
16290860 |
ttggcagcataggatggaggtttccc-ggggtgccaacctagttgggatgtc |
16290910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 142 - 192
Target Start/End: Original strand, 14413342 - 14413391
Alignment:
| Q |
142 |
tggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||||||||| ||| |||| | ||||||||||||||||||||||| |
|
|
| T |
14413342 |
tggcagcagaggatggaggtgtctc-gaggtgccaacctagttgggatgtc |
14413391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 192
Target Start/End: Original strand, 43856112 - 43856172
Alignment:
| Q |
131 |
ttttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||||||| ||||| ||| ||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
43856112 |
ttttatgagtttggcggcacaggatggaggtt-ctgcggggtgccaacctagttgggatgtc |
43856172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 18695520 - 18695575
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||||| ||||||||||||||| || ||| ||||||||||||| ||||||| |
|
|
| T |
18695520 |
tgagtttggcagtagaggatgggggtttatc-gggatgccaacctagtttggatgtc |
18695575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0363 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0363
Description:
Target: scaffold0363; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 142 - 192
Target Start/End: Complemental strand, 5369 - 5320
Alignment:
| Q |
142 |
tggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||||||||| ||| |||| | ||||||||||||||||||||||| |
|
|
| T |
5369 |
tggcagcagaggatggaggtgtctc-gaggtgccaacctagttgggatgtc |
5320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 147 - 192
Target Start/End: Complemental strand, 20740 - 20696
Alignment:
| Q |
147 |
gcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
20740 |
gcagaggatggaggtgtctc-ggggtgccaacctagttgggatgtc |
20696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 19160487 - 19160524
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgg |
186 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19160487 |
agaggatgggggtttctgtggggtgccaacctagttgg |
19160524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 20759886 - 20759923
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgg |
186 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20759886 |
agaggatgggggtttctgtggggtgccaacctagttgg |
20759923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 190
Target Start/End: Original strand, 26178065 - 26178106
Alignment:
| Q |
149 |
agaggatgggggtttctcaggggtgccaacctagttgggatg |
190 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26178065 |
agaggatggaggtttctgtggggtgccaacctagttgggatg |
26178106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 151 - 192
Target Start/End: Original strand, 37375023 - 37375063
Alignment:
| Q |
151 |
aggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37375023 |
aggatgggggttcctc-ggggtgccaacctagttgggatgtc |
37375063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 1862406 - 1862351
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||| ||| ||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
1862406 |
tgagtttggcggcataggatggaggtt-ctccggggtgccaacctagttgggatgtc |
1862351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 117 - 193
Target Start/End: Complemental strand, 7315225 - 7315149
Alignment:
| Q |
117 |
tttaataatatttattttatgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtct |
193 |
Q |
| |
|
|||||||||||||||| |||| | ||| ||| | |||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
7315225 |
tttaataatatttattatatgtgacgggcggcacaagatgggggtttcatagaggtgccaacctagttggcatgtct |
7315149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 12163394 - 12163449
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||||||||| ||||| ||||| |||||| | | ||||||||||||||||||||||| |
|
|
| T |
12163394 |
tgaggttggcggcagacgatggaggtttccc-gaggtgccaacctagttgggatgtc |
12163449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 169 - 209
Target Start/End: Complemental strand, 22980600 - 22980560
Alignment:
| Q |
169 |
gggtgccaacctagttgggatgtctgaggttctccctgatg |
209 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||||||| |
|
|
| T |
22980600 |
gggtgccaacctagttgggatgtttcagtttctccctgatg |
22980560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 38993176 - 38993121
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||| ||| |||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
38993176 |
tgagattggcggcataggatgggggtt-ctgcggggtgccaacctagttgggatgtc |
38993121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 67376 - 67431
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||||| ||||||||||||||| || ||| ||||||||||||| ||||||| |
|
|
| T |
67376 |
tgagtttggcagtagaggatgggggtttatc-gggatgccaacctagtttggatgtc |
67431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Original strand, 173867 - 173922
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||||||| | ||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
173867 |
tgagattggcagcataagatggaggtatctc-ggggtgccaacctagttgggatgtc |
173922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 18332780 - 18332725
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||| ||| ||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
18332780 |
tgagtttggcggcataggatggaggtt-ctccggggtgccaacctagttgggatgtc |
18332725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 136 - 192
Target Start/End: Complemental strand, 21487915 - 21487860
Alignment:
| Q |
136 |
tgaggttggcagcagaggatgggggtttctcaggggtgccaacctagttgggatgtc |
192 |
Q |
| |
|
|||| ||||| ||| |||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
21487915 |
tgagtttggcggcataggatgggggttcttc-ggggtgccaacctagttgggatgtc |
21487860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 151 - 191
Target Start/End: Original strand, 41917092 - 41917131
Alignment:
| Q |
151 |
aggatgggggtttctcaggggtgccaacctagttgggatgt |
191 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41917092 |
aggatgggggtt-ctccggggtgccaacctagttgggatgt |
41917131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University