View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13888_low_10 (Length: 287)
Name: NF13888_low_10
Description: NF13888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13888_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 12 - 115
Target Start/End: Original strand, 41405234 - 41405337
Alignment:
| Q |
12 |
atgaaggaaaagaagctgacagtggtgggtgacatagaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41405234 |
atgaaggaaaagaagctgacagtggtgggtgacatagaccctgttgatgttgtgagcaaattgagaaaaacttggcacacagaaattttaacggttgggc |
41405333 |
T |
|
| Q |
112 |
cggc |
115 |
Q |
| |
|
|||| |
|
|
| T |
41405334 |
cggc |
41405337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 192 - 268
Target Start/End: Original strand, 41405396 - 41405472
Alignment:
| Q |
192 |
ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatccctacatgactcaatactatcatgttca |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41405396 |
ccaaatgaacaaattgctgagcttattaagcaatacaaaggatacaatccctacatgactcaatactatcatgttca |
41405472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University