View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13888_low_11 (Length: 231)
Name: NF13888_low_11
Description: NF13888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13888_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 210
Target Start/End: Original strand, 35626675 - 35626875
Alignment:
| Q |
10 |
aagcataggacaggaagcccacaagtcttgcaggttttaacatcaacacctttttgaaaatgactccaaagttatattctggttgcttagcactcaactg |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35626675 |
aagcatgggacaggaagcccacaagtcttgcaggttttaacatcaacacctttttgaaaatgactccaaagttatattctggttgcttagcactcaactg |
35626774 |
T |
 |
| Q |
110 |
aagttaaaaatcatttaaattttgtgagaattgttttgaattaaaatttagtaataaattaatggatgaaaactgatgatgtcagagttcctaaggtagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35626775 |
aagttaaaaatcatttaaattttgtgagaattgttttgaattaaaatttagtaataaattaatggatgaaaactgatgatgtcagagttccttaggtagg |
35626874 |
T |
 |
| Q |
210 |
a |
210 |
Q |
| |
|
| |
|
|
| T |
35626875 |
a |
35626875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University