View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13889_high_1 (Length: 426)
Name: NF13889_high_1
Description: NF13889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13889_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 3e-18; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 279 - 338
Target Start/End: Complemental strand, 7304063 - 7304004
Alignment:
| Q |
279 |
tttcatcttgatgttgtggcttcaaaaaccatagtagggttttgagttgaattctgtgaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
7304063 |
tttcatcttgatgttgtggcttcaaaaactacaatagggttttgagttgaattctgtgaa |
7304004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 89 - 148
Target Start/End: Complemental strand, 7304251 - 7304192
Alignment:
| Q |
89 |
atgattagaacataaagctgaaattttgaatgttaaaaaagtcactgtgtacttgaagaa |
148 |
Q |
| |
|
||||||| || | ||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
7304251 |
atgattaaaataaaaagctgaaattttgaatgttgaaaaagttactgtgtacttgaagaa |
7304192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 414
Target Start/End: Complemental strand, 7303963 - 7303929
Alignment:
| Q |
380 |
ctgctacctcgtacctccattttgtctgtgtgtgt |
414 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7303963 |
ctgctacctcgtacctccattttgtctctgtgtgt |
7303929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 37 - 71
Target Start/End: Complemental strand, 7304303 - 7304269
Alignment:
| Q |
37 |
ttgtttgtagtacacaaactctgttttaaagggtt |
71 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
7304303 |
ttgtttgtagtacacaaactctgtttcaaagggtt |
7304269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University