View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13889_low_9 (Length: 241)
Name: NF13889_low_9
Description: NF13889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13889_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 24 - 231
Target Start/End: Original strand, 387723 - 387936
Alignment:
| Q |
24 |
aagtgtaagaagaaggatggtacttaaactaagggaagtgtatagattgatccattcagcattctatccttggcttagcagtggttactttcttgataat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
387723 |
aagtgtaagaagaaggatggtacttaaactaagggaagtgtatagattgatccatccagcattctatccttggcttagcagtggttactttcttgataat |
387822 |
T |
 |
| Q |
124 |
caggaaaatgttaattccaac------nnnnnnnnnntggtaatgtcactgaagcatcttgaaaatgtgtaaaatgggttctccctttctcgcccactga |
217 |
Q |
| |
|
||| || |||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
387823 |
cagtaacatgttaattccaacaaaaaaaaataaaaaatggtaatgtaactgaagcatcttgaaaatgtgttaaatgggttctccctttctcgcccactga |
387922 |
T |
 |
| Q |
218 |
tcaaaatgcctttg |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
387923 |
tcaaaatgcctttg |
387936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University