View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_high_19 (Length: 318)
Name: NF1388_high_19
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 77 - 261
Target Start/End: Complemental strand, 12122721 - 12122537
Alignment:
| Q |
77 |
ataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttcaatagatacagcttcagtagcaaaatggtgaagctgaaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122721 |
ataattcttgatttcatatgtttaatagcttttttgacaatttttattgttatttgtgttcaatagatacagcttcagtagcaaaatggtgaagctgaaa |
12122622 |
T |
 |
| Q |
177 |
atcccggagcatcaagttgccggtcaccaagcaaaaactggaatcctaggtccactgatagacgattctggaaaattctacaaac |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122621 |
atcccggagcatcaagttgccggtcaccaagcaaaaactggaatcctaggtccactgatagacgattctggaaaattctacaaac |
12122537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 107 - 261
Target Start/End: Complemental strand, 14692210 - 14692056
Alignment:
| Q |
107 |
tttttgacaatttttattgttatttgtgttcaatagatacagcttcagtagcaaaatggtgaagctgaaaatcccggagcatcaagttgccggtcaccaa |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
14692210 |
tttttgacaatttttgttgttatttgtgttcaatggatacagcttcagtaacaaaatggtgaagctgaaaatcccagagcaccaagttgcaggtcaccaa |
14692111 |
T |
 |
| Q |
207 |
gcaaaaactggaatcctaggtccactgatagacgattctggaaaattctacaaac |
261 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
14692110 |
gcaaaaaacggaatcctaggtcctctaatagacgattctggaaagttctacaaac |
14692056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University