View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_high_20 (Length: 307)
Name: NF1388_high_20
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_high_20 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 208 - 307
Target Start/End: Original strand, 42518916 - 42519015
Alignment:
| Q |
208 |
aaggtgaatagttggtgaagagtgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaaca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518916 |
aaggtgaatagttggtgaagagtgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaaca |
42519015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 42518717 - 42518838
Alignment:
| Q |
1 |
tgcatgcatagctgaaattttatcatagagtttctcagctaaaatattttatatgtaagctttcaaattccaagttcataccatattaccatgcagtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42518717 |
tgcatgcatagctgaaattttatcatagagtttctcagctaaaatattttatatgtaagctttcaaattccaagttca--------aaccatgcagtttg |
42518808 |
T |
|
| Q |
101 |
cattttcgataccaattaatccagatccgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42518809 |
cattttcgataccaattaatccagatccgg |
42518838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University