View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_high_29 (Length: 251)
Name: NF1388_high_29
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 141 - 231
Target Start/End: Original strand, 53841816 - 53841906
Alignment:
| Q |
141 |
tacttttcaacatcgtagcaaaatgtatgacctacaaattcctaaacaaatatatttttagagataagtatgatgattttaacttttaata |
231 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53841816 |
tacttttcaacatcatagcaaaatgtatgacctacaaattcctaaacaaatatatttttagaggtaagtatgatgattttaacttttaata |
53841906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 4706428 - 4706340
Alignment:
| Q |
10 |
gcagagaaagtgactgattgtaaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatccttttttaatct |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
4706428 |
gcagagagagtgactgattgtaaagggggagagaaaaagcataattcagtggtttgtcactaaagatatcatgtaccctttttttatct |
4706340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 29 - 93
Target Start/End: Complemental strand, 33762103 - 33762039
Alignment:
| Q |
29 |
gtaaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatcctttttt |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
33762103 |
gtaaagggggagagaaaaagcataatccagtggtttgtcattaaagatatcatgtaccctttttt |
33762039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 26393303 - 26393383
Alignment:
| Q |
18 |
agtgactgattgtaaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatccttttttaatct |
98 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
26393303 |
agtgattggttgtaaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatgtaccctttttttatct |
26393383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 21526942 - 21527010
Alignment:
| Q |
30 |
taaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatccttttttaatct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
21526942 |
taaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatgtaccctttttttatct |
21527010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 36254120 - 36254188
Alignment:
| Q |
30 |
taaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatccttttttaatct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
36254120 |
taaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatgtaccctttttttatct |
36254188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 1512465 - 1512545
Alignment:
| Q |
18 |
agtgactgattgtaaagggggagagaaaaagcataatccagtggtttgtcactaaagatatcatatatccttttttaatct |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||| |||| |
|
|
| T |
1512465 |
agtgactggctgtaaagggggagagaaaaagcataatccagtggtttgtcattaaagatattatgtatcctttttttatct |
1512545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University