View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_low_19 (Length: 366)
Name: NF1388_low_19
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_low_19 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 216 - 366
Target Start/End: Original strand, 13023114 - 13023263
Alignment:
| Q |
216 |
gacaacaaagcaccttgtggtggtgtgtgttgctttaccattttggtggtttcgtctttgggtatgttg-tatttgtttgattataattaccatggctga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13023114 |
gacaacaaagcaccttgtggtggtgtgt--tgctttaccattttggtggtttcgtctttggttatgttggtatttgtttgattataattaccatggctga |
13023211 |
T |
|
| Q |
315 |
attatgagctatcttcaaaggcattgagtttctaattgcaattatgttttca |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13023212 |
attatgagctatcttcaaaggcattgagtttctaattgcaattatgttttca |
13023263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 13022912 - 13023009
Alignment:
| Q |
16 |
atttcatcacaaatcacaatgaggatacctaatagtaccaagtcttcaagttttgagaaccccattgaggatggtctaacaagctaaatagaggaatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13022912 |
atttcatcacaaatcacaatgaggatatttaatagtaccaagtcttcaagttttgagaaccccattgaggatggtctaacaagctaaatagaggaatt |
13023009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 37 - 89
Target Start/End: Original strand, 11070895 - 11070948
Alignment:
| Q |
37 |
aggatacctaatag-taccaagtcttcaagttttgagaaccccattgaggatgg |
89 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
11070895 |
aggatacctaataggtaccaagtcttcaaattttgaaaaccccattaaggatgg |
11070948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 300 - 341
Target Start/End: Original strand, 27014475 - 27014516
Alignment:
| Q |
300 |
aattaccatggctgaattatgagctatcttcaaaggcattga |
341 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
27014475 |
aattaccatggcagaattatgagctatcttcaaaggcgttga |
27014516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University