View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_low_30 (Length: 298)
Name: NF1388_low_30
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_low_30 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 82 - 298
Target Start/End: Original strand, 32340464 - 32340678
Alignment:
| Q |
82 |
attataatgtcctatttatcttgttttgccaactgccttactggttctgaatctacannnnnnnnnnnatcgattttgtagcagtaaagttttatcatca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32340464 |
attataatgtcctatttatcttgttttgccaactgccttactggttctgaatctacattttttttt--atcgattttgtagcagtaaagttttatcatca |
32340561 |
T |
|
| Q |
182 |
tgattggatattttaccgtgtcttaatttttgtttgttagacctcctcggatttagtttgtccaatatcggacacgtgtcggtgtctaacacatgattac |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | |
|
|
| T |
32340562 |
tgattggatattttaccgtgtcttaatttttgtttgttagacctcctcggatttagtttgtccgatatcggatacgtgtcggtgtctaacacatgattgc |
32340661 |
T |
|
| Q |
282 |
attacattatgtcattt |
298 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
32340662 |
attaaattatgtcattt |
32340678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 29 - 86
Target Start/End: Complemental strand, 1747035 - 1746978
Alignment:
| Q |
29 |
ataaattacattgtttttctttgctttcccttgaattgtatcatctggatttgattat |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1747035 |
ataaattacattgtttttctttgctttcccttgaattgtatcatctggatttgattat |
1746978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University