View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1388_low_32 (Length: 292)
Name: NF1388_low_32
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1388_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 71 - 239
Target Start/End: Complemental strand, 31897897 - 31897730
Alignment:
| Q |
71 |
ctacatccgtgactgcatttcgtcgtagcataacaacatttgtcgcgaccatttttgtgatttttgctcactatgttaaaaccgaaattcaatgaaagca |
170 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||| |||||||||||| |||||||| |||||||||||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
31897897 |
ctacatcggtgactgcatttcatcgtagcgtaataacatttgtcgcaaccattttcgtgatttttgctcactatgtcaaaaccaaaaatcaatgaaagca |
31897798 |
T |
|
| Q |
171 |
cttaaaccaaagtatgatacctctgctgtgagaaaatcagcaagatttgggtgtaatattagtaagaat |
239 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31897797 |
cttaaaccaaa-tatgatatctctgctgtgagaaaatcagcaagatttgggtgtaatattagtaagaat |
31897730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University