View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1388_low_49 (Length: 203)

Name: NF1388_low_49
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1388_low_49
NF1388_low_49
[»] chr7 (1 HSPs)
chr7 (52-119)||(31844081-31844148)


Alignment Details
Target: chr7 (Bit Score: 60; Significance: 8e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 52 - 119
Target Start/End: Original strand, 31844081 - 31844148
Alignment:
52 ttgataatttgaagttttgtagcaagcaagatggtcagagacatactaacctccgactcattctagaa 119  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
31844081 ttgataatttgaagctttgtagcaagcaagatggtcagagacatactaacccccgactcattctagaa 31844148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University