View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13892_high_21 (Length: 234)
Name: NF13892_high_21
Description: NF13892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13892_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 29551357 - 29551555
Alignment:
| Q |
16 |
ataaggttgttccattctcctcaatttgcattgcatagtgagctccacacaaagtatagctagctagaaaaggaaaagctaggtatatatagagcttctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
29551357 |
ataaggttgttccattctcctcaatttgc-----atagtgagctccacacaaagtatagctagctacaaaagggaaagctaggtatatatagagcttctg |
29551451 |
T |
 |
| Q |
116 |
tgtttgtgtggaggcagagacaattcaaagaagtgattatggggatgatgtgtattagaatcatattgctactagctgcttattgcttgcttcctctatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29551452 |
tgtttgtgtggaggcagagacaattcaaataagtgattatggggattatgtgtattagaatcatatttctactagctgcttattgcttgcttcctctatc |
29551551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University