View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13892_high_22 (Length: 226)
Name: NF13892_high_22
Description: NF13892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13892_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 37632305 - 37632110
Alignment:
| Q |
17 |
ccaatttgtttcataacagaaaaaatcccagctgaatcactactgcagcagaaaacataattgatgatgttgtatgcgtgctgtcagcagccgaaaagca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
37632305 |
ccaatttgtttcataacagaaaaaatcccagccgaatcactactgcagcagaaaacagaattgatgatgctgtatgcgtgttgtcagcagccgaaaagca |
37632206 |
T |
|
| Q |
117 |
atcatcgacaccgtatacctcagcgtcaacctctcagtcaaattgatagatcaacttcgatctattacatatttaatcaatggcatacatatcaac |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37632205 |
atcaccgacaccgtatacctcagcgtcaacctctcagtcaaattgatagatcaacttcgatctattacatattcaatcaatggcatacatatcaac |
37632110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University