View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13892_low_19 (Length: 249)

Name: NF13892_low_19
Description: NF13892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13892_low_19
NF13892_low_19
[»] chr5 (2 HSPs)
chr5 (71-234)||(28309306-28309471)
chr5 (3-40)||(28309485-28309522)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 71 - 234
Target Start/End: Complemental strand, 28309471 - 28309306
Alignment:
71 taaatagtatgattaaaaatattaatgttttgttgaaactgaaatataatttataatctgtgacaannnnnnn--aaagtgacttatatattagaatgaa 168  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||         |||||||||||||||||||||||||    
28309471 taaatagtatgattaaaaatattaatgttttgttgaaactgatatataatttataatctgtgacaatttttttttaaagtgacttatatattagaatgaa 28309372  T
169 tggagtagaataatattcaaattattcaccataacctcactttacaatgaataatggtgtacaaat 234  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
28309371 tggagtagaataatattcaaattcttcaccataacctcactttacaatgaataatggtgtacaaat 28309306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 40
Target Start/End: Complemental strand, 28309522 - 28309485
Alignment:
3 aaaattgtactttacaaaattatcattcaaaattaaaa 40  Q
    |||||| |||||||||||||||||||||||||||||||    
28309522 aaaattatactttacaaaattatcattcaaaattaaaa 28309485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University