View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13893_high_23 (Length: 260)
Name: NF13893_high_23
Description: NF13893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13893_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 241
Target Start/End: Complemental strand, 49040132 - 49039901
Alignment:
| Q |
10 |
attattctgcatagcatccaacactgatctcccacctccatggatgcagaaatgctcaaatgccaatttgaaattcggtacataatttgatgacttcttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49040132 |
attattctgcatagcatccaacactgatctcccacctgcatggatgcagaaatgctcaaaagccaatttgaaattcggtacatagtttgatgacttcttt |
49040033 |
T |
|
| Q |
110 |
ctaaacaacgatatcataaacattaattgctccgaaaatggcaaaaccaatggacctaactcagttatgttatttttcaaggcttctcctgccactttca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040032 |
ctaaacaacgatatcataaacattaattgctccgaaaatggcaaaaccaatggacctaactcagttatgttatttttcaaggcttctcctgccactttca |
49039933 |
T |
|
| Q |
210 |
ttagctccttcgatagagacacacctgtgtac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49039932 |
ttagctccttcgatagagacacacctgtgtac |
49039901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University