View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13893_high_7 (Length: 474)

Name: NF13893_high_7
Description: NF13893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13893_high_7
NF13893_high_7
[»] chr5 (1 HSPs)
chr5 (100-165)||(1321082-1321147)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 100 - 165
Target Start/End: Original strand, 1321082 - 1321147
Alignment:
100 tggagcctgtaatacagttcatgctaaaatgtggggaatatacccggaaatgtaaatagcgagaag 165  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
1321082 tggagcctgtaatacagttcatgctaaaatgtggggaatatacacggaaatgtaaatagcgagaag 1321147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University