View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13893_low_16 (Length: 290)
Name: NF13893_low_16
Description: NF13893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13893_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 5 - 290
Target Start/End: Complemental strand, 49040401 - 49040120
Alignment:
| Q |
5 |
gagagatgaatagggtagttgttaacagagtcatcccatggatttcccgtccagtcatgtagaagtggtatgtcacgacatgccctccatacggcactgt |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040401 |
gagaaatgaatagggtagttgttaacagagtcatcccatggatttcccgtccagtcatgtagaagtggtatgtcacgacatgccctccatacggcactgt |
49040302 |
T |
 |
| Q |
105 |
tacatttaaaaccagccccaaatgcaatcaatctgccacaccctatccccctttgaaactctacccttggcctctacgtatgctaactcataccaaagtg |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040301 |
tacatttaaaacctgccccaaatgcaatc----tgccacaccctatccccctttgaaactctacccttggcctctacgtatgctaactcataccaaagtg |
49040206 |
T |
 |
| Q |
205 |
aactacttgaagtgttaccaaagcggtgtaatgtggaacgagatggctccatatgccactcacttagttctagattattctgcata |
290 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49040205 |
aactacttgaagtgttaccaaagcgatgtaatgtggaacaagatggctccatatgccactcacttagttctatattattctgcata |
49040120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Original strand, 19671772 - 19671813
Alignment:
| Q |
183 |
tatgctaactcataccaaagtgaactacttgaagtgttacca |
224 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19671772 |
tatgccaactcataccaaacagaactacttgaagtgttacca |
19671813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Original strand, 19742892 - 19742933
Alignment:
| Q |
183 |
tatgctaactcataccaaagtgaactacttgaagtgttacca |
224 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19742892 |
tatgccaactcataccaaacagaactacttgaagtgttacca |
19742933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 19797196 - 19797155
Alignment:
| Q |
183 |
tatgctaactcataccaaagtgaactacttgaagtgttacca |
224 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19797196 |
tatgccaactcataccaaacagaactacttgaagtgttacca |
19797155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University