View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13893_low_20 (Length: 267)
Name: NF13893_low_20
Description: NF13893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13893_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 46466652 - 46466401
Alignment:
| Q |
1 |
tgttctagtcataaaaaattatttaagtcaactaatgaattcaaaacatgcacattataggggcggggaggagaaaaacagaaacatatataggttccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46466652 |
tgttctagtcataaaaaattatttaagtcaactaatgaattcaaaacatgcacattataggggcggggaggagaaaaacagaaacata----ggttccct |
46466557 |
T |
 |
| Q |
101 |
tacaaaaatgtaaccaaatttatttttataatgtcaacttgacaatatatgattttcttatttcttacttcatccacaacttgcggcacatttacctata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46466556 |
tacaaaaatgtaaccaaatttatttttataatgtcaacttgacaatatatgattttcttattgcttacttcatccacaacttgcggcacatttacctata |
46466457 |
T |
 |
| Q |
201 |
taagttcatggcaaatgaactacactagtatctaaagaagcaatttctcaccttca |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46466456 |
taagttcatggcaaatgaactacactagtatctaaagaagcaatttctcaccttca |
46466401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University