View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13893_low_27 (Length: 239)
Name: NF13893_low_27
Description: NF13893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13893_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46466642 - 46466865
Alignment:
| Q |
1 |
tgactagaacatattaagttaatggtattgattggcatgtctgaactacnnnnnnnnnnnnnn--gataaaatagagggccaaagaccccatgtttgaac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46466642 |
tgactagaacatattaagttaatggtattgattggcatgtctgaactactttttttaatttttttgataaaatagagggccaaagaccccatgtttgaac |
46466741 |
T |
 |
| Q |
99 |
tactatgttcatgaatataaatatatttcatgtcacctaatgatattcattgctgccggcatttgaaa-tcagttttgtgcagtttgtcaacaatgcatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46466742 |
tactatgttcatgaatataaatatatttcatgtcacctaatgatattcattgctgccggcatttgaaattcagttttgtgcagtttgtcaacaatgcatg |
46466841 |
T |
 |
| Q |
198 |
tgtatgttagttagaatgtattct |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46466842 |
tgtatgttagttagaatgtattct |
46466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University