View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13894_high_8 (Length: 245)
Name: NF13894_high_8
Description: NF13894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13894_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 54656455 - 54656254
Alignment:
| Q |
20 |
gcacccaggagatacgatactcttttacttcataggccatggcaacaggcaaatggaaaacacaaaactcccaaatgataccggattcatggaatattta |
119 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54656455 |
gcacctaggagacacgatactcttttacttcataggccatggcaacaggcaaatggaaaacacaaaactcccaaatgataccggattcatggaatattta |
54656356 |
T |
|
| Q |
120 |
gttatggcagatagtacagtcatgactggtatattttaaaattactgatgttatctattttgcttgcagtaaaaaaaatcacttttttaacaatgaaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54656355 |
gttatggcagatagtacagtcatgactggtatattttaaaattactgatgttatctattttgtttgcagtaaaaaaaatcacttttttaacaatgaaatt |
54656256 |
T |
|
| Q |
220 |
tg |
221 |
Q |
| |
|
|| |
|
|
| T |
54656255 |
tg |
54656254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University