View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13894_low_10 (Length: 240)
Name: NF13894_low_10
Description: NF13894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13894_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 12552786 - 12552999
Alignment:
| Q |
9 |
ttatactcttatggacaaagtgagtcttcaaagcaggatatttcaaaaggtgaatcaagtttacaagatcttgattatagcaaaatgagaagcatttcat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12552786 |
ttatactcttatggacaaagtgagtcttcaaagcaggatatttcaaaaggtgaatcaagtttacaagatcttgattatagcaaaatgagaagcatttcat |
12552885 |
T |
 |
| Q |
109 |
gtgtaaatcaagaagaaaatctacttcctgctttggttgcttcctctcctagaactggaatcttcaatcaaatcgaaaatgaccgcaacaaagctcaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12552886 |
gtgtaaatcaagaagaaaatctacttcctgctttggttgcttcctctcctagaattggaatcttcaatcaaatcgaaaatgaccgcaacaaagctcaaat |
12552985 |
T |
 |
| Q |
209 |
gtccatcgatcact |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12552986 |
gtccatcgatcact |
12552999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University