View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13895_high_6 (Length: 240)
Name: NF13895_high_6
Description: NF13895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13895_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 31523468 - 31523229
Alignment:
| Q |
1 |
ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggccctttagggttcttttacatacttgtattatgtgaaacaatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523468 |
ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggcactttagggttcttttacatacttgtattatgtgaaacaatatc |
31523369 |
T |
 |
| Q |
101 |
tgattagtccttggattaatccttctagggctgaataccgagttttcaaaacnnnnnnntacaacacaattgaaaaaatgtatcagatacatcaactgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523368 |
tgattagtccttggattaatccttctagggctgaataccgagtttccaaaacaaaaaaatacaacacaattgaaaaaatgtatcagatacatcaactgca |
31523269 |
T |
 |
| Q |
201 |
aaaatgtatcagaaaatagataaattaccggaaacagaat |
240 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31523268 |
aaaatgtattagaaaatagataaattaccggaaacagaat |
31523229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 194 - 240
Target Start/End: Original strand, 52303 - 52349
Alignment:
| Q |
194 |
aactgcaaaaatgtatcagaaaatagataaattaccggaaacagaat |
240 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52303 |
aactgaaaaaatgtataggaaaatagataaattaccggaaacagaat |
52349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 52075 - 52126
Alignment:
| Q |
1 |
ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgat |
52 |
Q |
| |
|
||||| ||| ||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
52075 |
ttggtaaacaatacaatattgagaatttccagaaaatttcttaatttgtgat |
52126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University