View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13895_low_10 (Length: 218)
Name: NF13895_low_10
Description: NF13895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13895_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 5024035 - 5024221
Alignment:
| Q |
19 |
gaagtgtgaaatatacctaaatcttttgatatgtctgatttccttttaaccggagaaggtgggtcttctctatagaatgaagcatcaagaacagacacgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5024035 |
gaagtgtgaaatatacctaaatcttttgatatgtctgatttccttttaaccggggaaggtgggtcttctctatagaatgaagcatcaagaacagacacgg |
5024134 |
T |
 |
| Q |
119 |
gactgggttgttctgcagtaaccattgtttcaaccataaagctttccttgctcaagtcttgttctgcattctgatcatttctttcct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5024135 |
gactgggttgttctgcagtaaccattgtttcaaccataaaactttccttgctcaagtcttgttctgcattctgatcatttctttcct |
5024221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 4558322 - 4558412
Alignment:
| Q |
32 |
tacctaaatcttttgatatgtctgatttccttttaaccggagaaggtgggtcttctctatagaatgaagcatcaagaacagacacgggact |
122 |
Q |
| |
|
||||||||| |||||| | || |||||| |||| || ||||| ||||| ||||| ||||||||| ||||||||||||||| || ||||| |
|
|
| T |
4558322 |
tacctaaattttttgaaacgttcgatttcgttttcactggagatggtggatcttccttatagaatgcagcatcaagaacagatacaggact |
4558412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University