View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13895_low_7 (Length: 246)
Name: NF13895_low_7
Description: NF13895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13895_low_7 |
 | |
|
| [»] scaffold0008 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 88 - 234
Target Start/End: Original strand, 31523517 - 31523663
Alignment:
| Q |
88 |
tgtgaaagttgttaacattgtgttatataattatcttatatcacatgattgcttttgaaattggaattgaagttttttaatttcatttcctctttgtcca |
187 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523517 |
tgtgaaagttgttaataatgtgttatataattatcttatatcacatgattgcttttgaaatttgaattgaagttttttaatttcatttcctctttgtcca |
31523616 |
T |
|
| Q |
188 |
gaattatcatccctctagggtgcttactcttgtataccaaccatttg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523617 |
gaattatcatccctctagggtgcttactcttgtataccaaccatttg |
31523663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 31523474 - 31523519
Alignment:
| Q |
1 |
tagattgttacatcagtgcacattataactagccctcatatcttgt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31523474 |
tagattgttacatcagtgcacattataactagccctcatatcttgt |
31523519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 169 - 234
Target Start/End: Complemental strand, 51979 - 51914
Alignment:
| Q |
169 |
ttcatttcctctttgtccagaattatcatccctctagggtgcttactcttgtataccaaccatttg |
234 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51979 |
ttcatttcctctctgtgcagaattatcatccctctagggtgcttactcttgtataccaaccatttg |
51914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 173 - 234
Target Start/End: Complemental strand, 64431 - 64370
Alignment:
| Q |
173 |
tttcctctttgtccagaattatcatccctctagggtgcttactcttgtataccaaccatttg |
234 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
64431 |
tttcctctttgtgcagaaatatcatccctctagggtgcttactcttgtatatcagccatttg |
64370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 18096360 - 18096404
Alignment:
| Q |
190 |
attatcatccctctagggtgcttactcttgtataccaaccatttg |
234 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
18096360 |
attatcatccctccagggtgcttacacttgtataccagccatttg |
18096404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 37853966 - 37854010
Alignment:
| Q |
190 |
attatcatccctctagggtgcttactcttgtataccaaccatttg |
234 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
37853966 |
attatcatccctccagggtgcttacacttgtataccagccatttg |
37854010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University