View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13895_low_8 (Length: 240)

Name: NF13895_low_8
Description: NF13895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13895_low_8
NF13895_low_8
[»] chr1 (1 HSPs)
chr1 (1-240)||(31523229-31523468)
[»] scaffold0008 (2 HSPs)
scaffold0008 (194-240)||(52303-52349)
scaffold0008 (1-52)||(52075-52126)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 31523468 - 31523229
Alignment:
1 ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggccctttagggttcttttacatacttgtattatgtgaaacaatatc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
31523468 ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgataggcactttagggttcttttacatacttgtattatgtgaaacaatatc 31523369  T
101 tgattagtccttggattaatccttctagggctgaataccgagttttcaaaacnnnnnnntacaacacaattgaaaaaatgtatcagatacatcaactgca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||       |||||||||||||||||||||||||||||||||||||||||    
31523368 tgattagtccttggattaatccttctagggctgaataccgagtttccaaaacaaaaaaatacaacacaattgaaaaaatgtatcagatacatcaactgca 31523269  T
201 aaaatgtatcagaaaatagataaattaccggaaacagaat 240  Q
    ||||||||| ||||||||||||||||||||||||||||||    
31523268 aaaatgtattagaaaatagataaattaccggaaacagaat 31523229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 194 - 240
Target Start/End: Original strand, 52303 - 52349
Alignment:
194 aactgcaaaaatgtatcagaaaatagataaattaccggaaacagaat 240  Q
    ||||| ||||||||||  |||||||||||||||||||||||||||||    
52303 aactgaaaaaatgtataggaaaatagataaattaccggaaacagaat 52349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 52075 - 52126
Alignment:
1 ttggttaactatacaatcttgagattttccagaaaatttctgaatttgtgat 52  Q
    ||||| ||| ||||||| |||||| |||||||||||||||| ||||||||||    
52075 ttggtaaacaatacaatattgagaatttccagaaaatttcttaatttgtgat 52126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University