View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13896_high_18 (Length: 273)
Name: NF13896_high_18
Description: NF13896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13896_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 12398673 - 12398432
Alignment:
| Q |
11 |
gatgaatggtgtacagaaattataaataagctcaactaaatggacaagtatgctcagccaacagccaattctttcattcgtagatataataattgacaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12398673 |
gatgaatggtgtacagaaattataaataagctcaactaaatggacaagtatgctcagccaacagccaattctttcattcgtagatataataattgacaag |
12398574 |
T |
 |
| Q |
111 |
taacaagatctgtacatacaataagttaacaacggccctcagttgtattcaataaatatcatctgtctcagactatgtttatccctagaatgaaaagtca |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12398573 |
tatcaagatctgtacatacaataagttaacaacggccctcagttgtattcaataaatatcatctgtctcagactatgtttatcccta----gaaaagtca |
12398478 |
T |
 |
| Q |
211 |
aatgagcgccctgataatttcttgggttctaattaaggaccaggat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12398477 |
aatgagcgccctgataatttcttgggttctaattaaggaccaggat |
12398432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University