View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13896_low_20 (Length: 240)
Name: NF13896_low_20
Description: NF13896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13896_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42804836 - 42805052
Alignment:
| Q |
1 |
actaatggtaatggcccttctataaggtcccattgcccctatcctacttggtcttccttctactcatagcaagcctccatgaaaggaaggtttgacactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42804836 |
actaatggtaatggcccttctataaggtcccattgcccctatcctacttggtcttccttctactcatagcaagcctccatgaaaggaaggtttcacactt |
42804935 |
T |
 |
| Q |
101 |
actccaaattgaaaaaagcatctcatactcacttttactttccttcacttcaaaatcccatcaaattacattcaannnnnnngtttacaactttaggtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42804936 |
actccaaattgaaaaaagcatctcatactcacttttactttccttcacttcaaaatcccatcaaattacattcaatttttttgtttacaactttaggtgg |
42805035 |
T |
 |
| Q |
201 |
catcctgatttcttgcc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42805036 |
catcctgatttcttgcc |
42805052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University