View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13897_high_19 (Length: 244)
Name: NF13897_high_19
Description: NF13897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13897_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 5 - 239
Target Start/End: Original strand, 3088182 - 3088415
Alignment:
| Q |
5 |
tgaggatatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgtaaggaactcatgtct |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088182 |
tgaggacatgtgtgttgcaggagctatcaaaaatttcacttctcaactttctcattacaaagagggaacatctgatcgtagatgtaaggaactcatgtct |
3088281 |
T |
|
| Q |
105 |
gtcatttattttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgttnnnnnnnnnnnnntaccattaactggag |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3088282 |
gtcattttttttccctttcagaaatttttagacttattttacttcatgatattaattactggagattttgtt-aaaaaaaaaaaatactattaactggag |
3088380 |
T |
|
| Q |
205 |
atattgcagataatatgaccgaggcattattgttc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088381 |
atattgcagataatatgaccgaggcattattgttc |
3088415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University