View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13897_high_22 (Length: 205)

Name: NF13897_high_22
Description: NF13897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13897_high_22
NF13897_high_22
[»] chr3 (1 HSPs)
chr3 (1-186)||(17687582-17687766)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 17687582 - 17687766
Alignment:
1 ctattctaggctttgggatttatattttggtggtggatcttcaaactagatgtttcacgaatataaacaattgctggtatgagaaacaagcaaggctctc 100  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||    
17687582 ctattctaggctttggggtttatattttggtggtggatcttcaaactggatgtttcacgaatataaacaattgccggtatgagaaacaa-caaggctctc 17687680  T
101 aattgttcaagtgtaatgtttgtttaattagtggggctaataatatcctgattattaagttatggtgtccttaacatacttatcat 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
17687681 aattgttcaagtgtaatgtttgtttaattagtggggctaataatatcctgattattaagttatagtgtccttaacatacttatcat 17687766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University