View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13897_low_24 (Length: 202)

Name: NF13897_low_24
Description: NF13897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13897_low_24
NF13897_low_24
[»] chr8 (1 HSPs)
chr8 (17-187)||(3603887-3604057)


Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 187
Target Start/End: Complemental strand, 3604057 - 3603887
Alignment:
17 gaagtagatggaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacaccctctatcaagattcaagaacttgca 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
3604057 gaagtagatggaagatatttgtgaagttgtatatgcatatcatttgtaacttctgaatataggcttaaaaacactctctatcaagattcaagaacttgca 3603958  T
117 taactgtacgtgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaag 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3603957 taactgtacgtgcaaggaatcattcaaaggcaatgcccgctgtagaataatggagaagacagtgtcaaaag 3603887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University