View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13898_high_10 (Length: 406)
Name: NF13898_high_10
Description: NF13898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13898_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 16 - 395
Target Start/End: Complemental strand, 38612448 - 38612069
Alignment:
| Q |
16 |
agtaccaaccggaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaatcgagtagaaaatca |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612448 |
agtaccaaccgaaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagacggcaccggaagcgaatcgagtagaaaatca |
38612349 |
T |
|
| Q |
116 |
cttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctcaatagcaacttccgcagacttttcagcaagta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612348 |
cttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctcaatagcaacttccgcagacttttcagcaagta |
38612249 |
T |
|
| Q |
216 |
actgtnnnnnnngctccgtagaccgtgacaccaagaacaacgcttctgaactcaccctcttcacgtctttgtccagagtgattatcttcttcactctact |
315 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612248 |
actgtaaaaaaagctccgtagaccgtgacaccaagaacaaagcttctgaactcaccctcttcacgtctttgtccagagtgattatcttcttcactctact |
38612149 |
T |
|
| Q |
316 |
cttcggaaactctggttcagacgacagcgttttctcttcttcttcacccataaccgtaacaattacaattcccaattcat |
395 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38612148 |
cttcggaaactctggttcaaacgacagcgttttctcttcttcttcacccataaccgtagcaattacaattcccaattcat |
38612069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University