View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13898_high_26 (Length: 228)
Name: NF13898_high_26
Description: NF13898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13898_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 88 - 218
Target Start/End: Complemental strand, 49411912 - 49411781
Alignment:
| Q |
88 |
gattgtctattagaatcaattcaaccacaccctaaaattaaactccatcgatttgatcaaagttacgatttttaacgtgcaatgttaagacatggtggaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
49411912 |
gattgtctattagaatcaattcaaccacaccctaaaattaaactccttcgatttgatcaaagttaagattttgaatgtgcaatgttaagacatggtggaa |
49411813 |
T |
 |
| Q |
188 |
atttagt-gagacaaaaacaaagttgctatgt |
218 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |
|
|
| T |
49411812 |
atttagtggagacaaaaacaaagttgttatgt |
49411781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University