View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13898_high_26 (Length: 228)

Name: NF13898_high_26
Description: NF13898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13898_high_26
NF13898_high_26
[»] chr3 (1 HSPs)
chr3 (88-218)||(49411781-49411912)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 88 - 218
Target Start/End: Complemental strand, 49411912 - 49411781
Alignment:
88 gattgtctattagaatcaattcaaccacaccctaaaattaaactccatcgatttgatcaaagttacgatttttaacgtgcaatgttaagacatggtggaa 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| || ||||||||||||||||||||||||    
49411912 gattgtctattagaatcaattcaaccacaccctaaaattaaactccttcgatttgatcaaagttaagattttgaatgtgcaatgttaagacatggtggaa 49411813  T
188 atttagt-gagacaaaaacaaagttgctatgt 218  Q
    ||||||| |||||||||||||||||| |||||    
49411812 atttagtggagacaaaaacaaagttgttatgt 49411781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University