View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13898_low_14 (Length: 347)
Name: NF13898_low_14
Description: NF13898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13898_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 104 - 330
Target Start/End: Original strand, 45556272 - 45556498
Alignment:
| Q |
104 |
tagtttgaagcatagatcattgatctccattttacttcaccaaaagcacaatcacactcaaaccacaattcaatcctccaaagttatatctcataagtac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45556272 |
tagtttgaagcatagatcattgatctccattttacttcaccaaaagcacaatcacactcaaaccacaattcaatcctccaaagttatatctcataagtac |
45556371 |
T |
 |
| Q |
204 |
ttattgtttcgaataatctcataagtacttcacagagcaagtttatgcttattctccgtttggttactcagaaaacgagatacataagtactaaagagca |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45556372 |
ttattgtttcgaataatctcataagtacttcacagagcaagtttatgcttattctccgtttggttactcagaaaacgagatacataagtactaaagagca |
45556471 |
T |
 |
| Q |
304 |
tggttgttgtagacggaagcgatttat |
330 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
45556472 |
tggttgttgtagacggaagagatttat |
45556498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University