View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13898_low_18 (Length: 270)
Name: NF13898_low_18
Description: NF13898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13898_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 3524378 - 3524618
Alignment:
| Q |
16 |
caagttagagtcaccctcgttgaaccacttcaccctccctctttggtacataatactatgtttactcttcaaaagcaaccaaagatccgannnnnnnnca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3524378 |
caagttagagtcaccctcgttgaaccacttcaccctccctctttggtacataatactatgtttactcttcaaaagcaaccaaagatccgattttttttca |
3524477 |
T |
 |
| Q |
116 |
aacctaagacctcctctttagtaagaccctcttattcatat--ttgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatcccc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524478 |
aacctaagacctcctctttagtaagaccctcttattcatatatttgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatcccc |
3524577 |
T |
 |
| Q |
214 |
atacacttttcagttccacttcttgatttcaccctttatca |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524578 |
atacacttttcagttccacttcttgatttcaccctttatca |
3524618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University