View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_high_66 (Length: 249)
Name: NF13899_high_66
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_high_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 32874678 - 32874508
Alignment:
| Q |
1 |
aattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874678 |
aattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgt |
32874579 |
T |
 |
| Q |
101 |
ttctgggagaaccacgtaatatctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac |
171 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32874578 |
ttctgggagaacgacgtaatatctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac |
32874508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 32874478 - 32874442
Alignment:
| Q |
201 |
tattttactttattattgtatatgattgaacctattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874478 |
tattttactttattattgtatatgattgaacctattc |
32874442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University