View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_high_72 (Length: 230)
Name: NF13899_high_72
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_high_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 48256275 - 48256075
Alignment:
| Q |
16 |
atatagctagctagggccttagggggtgaaacattacata----gtgccactgccatatataacgacacacataaccgtgtgaactgtgatccaacctta |
111 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48256275 |
atatagctagctagggcct-agggggtgaaatattacatatatagtgccactgccatatataacgacacacataaccgtgtgaactgtgatccaacctta |
48256177 |
T |
 |
| Q |
112 |
tctcaaaccaaagtgatttatctataatagtacgcaatatctacacttacattacccacaccgtccaaaatggtcacttttgccatgtgtttgatcatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48256176 |
tctcaaaccaaagtgatttatctataatagtacgcaatatctacacttacattacccacaccgtccaaaatggtcacttttgccatgtgtttgatcatta |
48256077 |
T |
 |
| Q |
212 |
ac |
213 |
Q |
| |
|
|| |
|
|
| T |
48256076 |
ac |
48256075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University