View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_high_74 (Length: 223)
Name: NF13899_high_74
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_high_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 54082388 - 54082177
Alignment:
| Q |
1 |
gtaaattttattgatggctaaaagtggttccattgaagg----ctatggtgtgggaaggcggcattattagaagcaaacaatagagttatagacaaacaa |
96 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54082388 |
gtaaattttattgatggctaaatgtggttccattgaaggaaggctatggtgtgggaaggcggcattattagaagcaaacaatagagttatagaaaaacaa |
54082289 |
T |
 |
| Q |
97 |
agtgtagcaaccaagttcagccaattgtggccatatctcacaatatatagactacacagcagatgtagttccgttttattgtacctacgtctcactagct |
196 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54082288 |
agtttagcaaccaagttcagccaattgtggccatatctcacaatatatagactacacagcagatgtagttccgttttattgtacctacgtctcactagct |
54082189 |
T |
 |
| Q |
197 |
ttgcacgttcgt |
208 |
Q |
| |
|
||| |||||||| |
|
|
| T |
54082188 |
ttgtacgttcgt |
54082177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University