View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_high_75 (Length: 221)
Name: NF13899_high_75
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_high_75 |
 | |
|
| [»] scaffold0191 (2 HSPs) |
| | |
|
| [»] scaffold0037 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0191 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 17756 - 17946
Alignment:
| Q |
1 |
ttttggaccgtctaatcttgatcgaacaaccacctatgtccgaactacgtgaatgcgagactagggaatccaaattcacatataggatgttgttttccat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17756 |
ttttggaccgtctaatcttgatggaacaaccacctatgtccgaactacgtgaatgcgagactagggaatccaaattcacatataggatgttgttttccat |
17855 |
T |
|
| Q |
101 |
ttttcctatctttctttcattgacattagcctatatgaatattgttgcgttgtttatagattcttctttgtatagtcatgttttccttttg |
191 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17856 |
ttttcctatctttctttctttgacattagcctatatgaatattgttgcgttgtttatagattcttctttgtatagtcatgttttccttttg |
17946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Original strand, 18844 - 18877
Alignment:
| Q |
158 |
agattcttctttgtatagtcatgttttccttttg |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
18844 |
agattcttctttgtatagccatgttttccttttg |
18877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 99955 - 99922
Alignment:
| Q |
158 |
agattcttctttgtatagtcatgttttccttttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
99955 |
agattcttctttgtatagtcatgttttccttttg |
99922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University