View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13899_high_78 (Length: 208)

Name: NF13899_high_78
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13899_high_78
NF13899_high_78
[»] chr4 (1 HSPs)
chr4 (1-193)||(44315279-44315470)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 44315279 - 44315470
Alignment:
1 actatcgatggagggtattttaggtgcctgaaaatcaatcacctttcttggatctagatttggaatacggggtggttatgttaacgggatttggaacaat 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||    
44315279 actatcgattgagggtattttaggtgcctgaaaatcaatcacctttcttggatctagatttggaatacggg-tggttatgttaatgggatttggaacaat 44315377  T
101 aaataatacttgagtttgaggggagcacagttatcaacccaagtcaaaacccaaaattgcaagctcatactaggaagtgtatgagatcatact 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44315378 aaataatacttgagtttgaggggagcacagttatcaacccaagtcaaaacccaaaattgcaagctcatactaggaagtgtatgagatcatact 44315470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University