View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_high_80 (Length: 205)
Name: NF13899_high_80
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_high_80 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 21 - 186
Target Start/End: Original strand, 23937885 - 23938050
Alignment:
| Q |
21 |
aaaatgaataaattttagtatttaagttaccatgtggaaccaatgcaatgtagtgatgaaacatggcaaggtaccacattaattaataatacaactgcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23937885 |
aaaatgaataaattttagtatttaagttaccatgtggaaccaatgcaatgtagtgatgaaacatggcaaggtaccacattaattaataatacaactgcaa |
23937984 |
T |
 |
| Q |
121 |
ttaccaattagctttaagtgcctaaacataaaaaataagatgttacactttcttgggagactatgg |
186 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23937985 |
ttaccaattagctttaagtgcctgaacataaaaaataagatgttacactttcttgggagaatatgg |
23938050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University