View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_29 (Length: 397)
Name: NF13899_low_29
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 17 - 387
Target Start/End: Original strand, 14518125 - 14518491
Alignment:
| Q |
17 |
gatatttataccgacacatttgcatcaggaataatttgagaaaatagatgtaattgaacgaaaccacacatgtcaatgtcgtctcagtgtcggatacaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14518125 |
gatatttataccgacacatttgcatcatgaataatttgagaaaatagatgtaattgaacgaaaccacacgtgtcaatgtcgtctcagtgtcggatacaag |
14518224 |
T |
 |
| Q |
117 |
acacttctttaatccgaattgccgatgctagatagatagtcatataaaataaattaatttaatgcatgtcttaccagttccaatattagagtgttgaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14518225 |
acacttctttaatccgaattgccgatgctagatagatagtcatataaaataaattaatttaatg----tcttaccagttccaatattagagtgttgaatt |
14518320 |
T |
 |
| Q |
217 |
tctacatcctgtgtattttgcaagtgaatgccatcagtgtttggactattttccggggaagatattgtaatattgtcaactttgattccctttgagttgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518321 |
tctacatcctgtgtattttgcaagtgaatgccatcagtgtttggactattttccggggaagatattgtaatattgtcaactttgattccctttgagttgt |
14518420 |
T |
 |
| Q |
317 |
caaattttagatggcatagaggactgtttttgattttgatatctctaatctttacaaagttgctagaataa |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14518421 |
caaattttagatggcatagaggactgtttttgattttgatatctctaatctttacaaagttgctagaataa |
14518491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University