View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_31 (Length: 382)
Name: NF13899_low_31
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 74 - 194
Target Start/End: Complemental strand, 38348924 - 38348804
Alignment:
| Q |
74 |
caatgaaccaagacctaaaataacaatctaggtcaagaaaaccaaagtaaaggacaatataaaaatatactattcatagaaattaagagtcaacaagaaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348924 |
caatgaaccaagacctaaaataacaatctaggtcaagaaaaccaaagtaaaggacaatataaaaatatactattcatagaaattaagagtcaacaagaaa |
38348825 |
T |
 |
| Q |
174 |
cagtaaaaccaggttggcatg |
194 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38348824 |
cagtaaaaccaggttggcatg |
38348804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 259 - 364
Target Start/End: Complemental strand, 38348739 - 38348634
Alignment:
| Q |
259 |
cacgcctgccagaacataacagaaactaagaaaggaataaacgagagatgcttcttctaacagtaatttcactcaccttttaggtttaaagtttgttgtg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38348739 |
cacgcctgccagaacataacagaaactaagaaaggaataaacgagagatgcttcttctaacagtaatttcactcaccttttaggtttaaagtttgttgtg |
38348640 |
T |
 |
| Q |
359 |
cgtctt |
364 |
Q |
| |
|
||||| |
|
|
| T |
38348639 |
tgtctt |
38348634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University