View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_32 (Length: 380)
Name: NF13899_low_32
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 104 - 370
Target Start/End: Original strand, 28053996 - 28054262
Alignment:
| Q |
104 |
tttatcaaccaaccaatcacaaaacgctgcaatttgcttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagattgtct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28053996 |
tttatcaaccaaccaatcacaaaacgctgcaatttgcttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagattgact |
28054095 |
T |
|
| Q |
204 |
ttggtaggagtgtttgaacttttcggcaggtcgttttcaatgcaaaaagtcgtatccgtagatttgactggagattttttgttctcgtgatctaatgtac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28054096 |
ttggtaggagtgtttgaacttttcggcacgtcgttttcagtgcaaaaagtcgtatccgtagatttgactggagattttttcttctcgtgatctaatgtac |
28054195 |
T |
|
| Q |
304 |
tactctttgaagattcatcgaaccttttctctggaaattgcctaggaaaaaagtaagttgctctgtg |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054196 |
tactctttgaagattcatcgaaccttttctctggaaattgcctaggaaaaaagtaagttgctctgtg |
28054262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University