View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_39 (Length: 357)
Name: NF13899_low_39
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 99 - 345
Target Start/End: Complemental strand, 24112716 - 24112473
Alignment:
| Q |
99 |
atctatggatctgtgatgttatttaatactgcgttatctatctgaaacctcactagaggatttgaggagaatttagtttactgagatccaaacttatagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24112716 |
atctatggatctgtgatgttatttaatactgcgttatctatctgaaacctcactagaggatttgaggagaatttagtttactgagatccaaagttatagg |
24112617 |
T |
 |
| Q |
199 |
atattaagtataaactttttattgtttttctctgttgttgttactgggagatgaatatgatgnnnnnnntaatgaaagatatctgaaaatcaaatacaaa |
298 |
Q |
| |
|
||| ||||||||||||| || |||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24112616 |
ata-taagtataaacttgtttttgtttttctctgttgttgttaatggaagatgaatatgatgaaaaaaataatgaaagatatctgaaaatcaaatac-tt |
24112519 |
T |
 |
| Q |
299 |
agtatttgatatgatcgaacaaaaattatcgctacgttctttctgat |
345 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24112518 |
tgtatttgatatgatcgaac-aaaattatcgctacgttctttctgat |
24112473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University