View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_43 (Length: 352)
Name: NF13899_low_43
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 1790275 - 1790393
Alignment:
| Q |
97 |
agaaaaagataagtgaaatgctttgcccaatggatctatcaataggaacaactccactacaatagcaacattatatttaactcttttattttatagtgtt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790275 |
agaaaaagataagtgaaatgctttgcccaatggatctatcaataggaacaactccactataatagcaacattatatttaactcttttattttatagtgtt |
1790374 |
T |
 |
| Q |
197 |
acattcaaaagttttatat |
215 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1790375 |
acattcaaaagttttatat |
1790393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University