View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_57 (Length: 293)
Name: NF13899_low_57
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_57 |
 | |
|
| [»] scaffold1108 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 83 - 164
Target Start/End: Original strand, 20562915 - 20562997
Alignment:
| Q |
83 |
aatatatttggg-cagtgtagctctctgcactatctttttggttaaaaaatattatctaaccagatagttcgctagtcaatac |
164 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20562915 |
aatatatttggggcagtgtagctctccgcactatctttttggttaaaaaatattatctaaccagatagttcgctagtcaatac |
20562997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 238 - 288
Target Start/End: Original strand, 20563071 - 20563121
Alignment:
| Q |
238 |
gcaataggaaagtctctcaattagtgaatttggttttctagaattatctac |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20563071 |
gcaataggaaagtctctcaattagtgaatttggttttctagaattatctac |
20563121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 287
Target Start/End: Original strand, 20603984 - 20604025
Alignment:
| Q |
246 |
aaagtctctcaattagtgaatttggttttctagaattatcta |
287 |
Q |
| |
|
|||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
20603984 |
aaagtctctccatttgagaatttggttttctagaattatcta |
20604025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1108 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold1108
Description:
Target: scaffold1108; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 94 - 164
Target Start/End: Original strand, 1529 - 1599
Alignment:
| Q |
94 |
gcagtgtagctctctgcactatctttttggttaaaaaatattatctaaccagatagttcgctagtcaatac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
1529 |
gcagtgtagctctctgcactatctttttggttaaaaaatattatctaaccagatagttccctagtgaatac |
1599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1108; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 287
Target Start/End: Original strand, 1673 - 1722
Alignment:
| Q |
238 |
gcaataggaaagtctctcaattagtgaatttggttttctagaattatcta |
287 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1673 |
gcaataagaaagtctctcaattagagaatttggttttctagaattatcta |
1722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University