View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13899_low_61 (Length: 266)
Name: NF13899_low_61
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13899_low_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 250
Target Start/End: Complemental strand, 14042556 - 14042326
Alignment:
| Q |
20 |
atatctaaggtgcaataattcagcttagtcataaagaaagagagtaccaaattaataatacaactcctacttcaataaacaaaaaattccttcaatggca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14042556 |
atatctaaggtgcaataattcagcttagtcataaagaaagagagtaccaaattaataatacaactcctacttcaataaacaaaaaattccttctatggca |
14042457 |
T |
 |
| Q |
120 |
ctcaccattacccactcttggcataaaattaggacccctttggttccattatcttgccaaggtagaagaccaaccatctctaactccaatcatgaagaaa |
219 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14042456 |
ctcaccattacccactcttggtatagaattaggacccctttggttccattatcttgccaaggtagaagaccaaccatctctaactccaatcatgaagaaa |
14042357 |
T |
 |
| Q |
220 |
agaaagacatggaaggaagaggagcaaagag |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
14042356 |
agaaagacatgggaggaagaggagcaaagag |
14042326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University