View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13899_low_66 (Length: 249)

Name: NF13899_low_66
Description: NF13899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13899_low_66
NF13899_low_66
[»] chr4 (2 HSPs)
chr4 (1-171)||(32874508-32874678)
chr4 (201-237)||(32874442-32874478)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 32874678 - 32874508
Alignment:
1 aattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32874678 aattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgt 32874579  T
101 ttctgggagaaccacgtaatatctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac 171  Q
    |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
32874578 ttctgggagaacgacgtaatatctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac 32874508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 32874478 - 32874442
Alignment:
201 tattttactttattattgtatatgattgaacctattc 237  Q
    |||||||||||||||||||||||||||||||||||||    
32874478 tattttactttattattgtatatgattgaacctattc 32874442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University